View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13711_low_24 (Length: 314)
Name: NF13711_low_24
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13711_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 264
Target Start/End: Original strand, 48542559 - 48542804
Alignment:
| Q |
20 |
atgaatggatggatggatgagtcaggttttgttaggagaatgttgcatgtaaagattttctgttgggtgaaaatgattatttatttattggaattaatgt |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48542559 |
atgaatggatgaatggatgagtcaggttttgttaggagaatgttgcatgtaaagattttctgttgggtgaaaataattatttatttattggaattaatgt |
48542658 |
T |
 |
| Q |
120 |
aaagaaaattaattagttgggtttggtgggatagtttttccaatcaatatgagccaagagtcgttctctgaattggtttttcactgtgcaatt-caccct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
48542659 |
aaagaaaattaattagttgggtttggtgggatagtttttccaatcaatatgagccaagagtcgttctctgaattggtttttcactgtacaattccaccct |
48542758 |
T |
 |
| Q |
219 |
ttgtgaaataacaccggatcgatagtgtcttggaatacattattga |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48542759 |
ttgtgaaataacaccggatcgatagtgtcttggaatacattattga |
48542804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University