View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13711_low_34 (Length: 251)
Name: NF13711_low_34
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13711_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 166 - 234
Target Start/End: Complemental strand, 12897323 - 12897255
Alignment:
| Q |
166 |
tacttgacccttttaattcttattggtaaattgtaccttgaggattttgagtagcataaatgagctaat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
12897323 |
tacttgacccttttaattcttattggtaaattgtaccttgaggattttgaggagcataaatgaggtaat |
12897255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 101
Target Start/End: Complemental strand, 12897459 - 12897424
Alignment:
| Q |
66 |
caattaaatttcattgtatgtgactccagtcaccat |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12897459 |
caattaaatttcattgtatgtgactcgagtcaccat |
12897424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University