View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13711_low_36 (Length: 237)

Name: NF13711_low_36
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13711_low_36
NF13711_low_36
[»] chr1 (1 HSPs)
chr1 (1-222)||(43259226-43259447)


Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 43259447 - 43259226
Alignment:
1 taaagtatatctctcatattatcaacttattatcttacgttcataattacatttctaatgataaaaaactatagaaatctttgatatgttagagatgctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43259447 taaagtatatctctcatattatcaacttattatcttacgttcataattacatttctaatgataaaaaactatagaaatctttgatatgttagagatgctg 43259348  T
101 attgaaatctgtaattttccatcttttaacacttagctcttcaaaaatcaacctgcaaaacccacctttagtgtgtgtgattctcgttgccggcctctta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
43259347 attgaaatctgtaattttccatcttttaacacttagctcttcaaaaatcaacctgcaaaacacacctttagtgtgtgtgattctcgttgccggcctctta 43259248  T
201 ttaaacttaaaagaagaaatat 222  Q
     |||||||||||||||||||||    
43259247 ataaacttaaaagaagaaatat 43259226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University