View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13711_low_8 (Length: 500)
Name: NF13711_low_8
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13711_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 433 - 482
Target Start/End: Original strand, 3162947 - 3162996
Alignment:
| Q |
433 |
gcgatacagaacatgcactgtccactatccgagttattctttctttttct |
482 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
3162947 |
gcgatacagaacatgcactgtccactattcgagtttttgtttctttttct |
3162996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University