View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13711_low_8 (Length: 500)

Name: NF13711_low_8
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13711_low_8
NF13711_low_8
[»] chr8 (1 HSPs)
chr8 (433-482)||(3162947-3162996)


Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 433 - 482
Target Start/End: Original strand, 3162947 - 3162996
Alignment:
433 gcgatacagaacatgcactgtccactatccgagttattctttctttttct 482  Q
    |||||||||||||||||||||||||||| |||||| || |||||||||||    
3162947 gcgatacagaacatgcactgtccactattcgagtttttgtttctttttct 3162996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University