View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13713_low_6 (Length: 238)
Name: NF13713_low_6
Description: NF13713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13713_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 36181811 - 36182031
Alignment:
| Q |
18 |
tgaatggtagaaattaatgaatagaagtaattaagtacctttaaaggaagcatgtagcatatgaacatgtatctccggaagctagctatgttgctaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36181811 |
tgaatggtagaaattaatgaatagaagtgattaactacctttaaaggaagcatgtagcatatgaacatgtatctccggaagctagctatgttgctaaaca |
36181910 |
T |
|
| Q |
118 |
cagtaatattgccaaccttaatcgattttccatccttgtttatcaatggttttttggtgaaatatctaaggttatagtctctgaaagtacggtaggtaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36181911 |
cagtaatattgccaaccttaatcgattttccatccttgtttatcaatggttttttggtgaaatatctaaggttatagtctctgaaagtacggtacgtaat |
36182010 |
T |
|
| Q |
218 |
tggatttctaatagaggaacc |
238 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
36182011 |
tgggtttctaatagaggaacc |
36182031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University