View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_13 (Length: 336)
Name: NF13714_low_13
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_13 |
 |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 26)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 183 - 318
Target Start/End: Complemental strand, 27136623 - 27136488
Alignment:
| Q |
183 |
ttcctaaatttgcaaggcaatgtccctatctatagttattaaatttagcaaaattatcacacaaacatcctcaggtgtgtctcctactagtaatttgatt |
282 |
Q |
| |
|
|||| |||| |||||||| ||||| ||||||||||| | | ||||| ||||||||||||| ||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
27136623 |
ttccaaaatatgcaaggcgatgtcactatctatagtcaatggatttatcaaaattatcacaaaaacatccttgagtgtatcttctactagtaatttgatg |
27136524 |
T |
 |
| Q |
283 |
gaccaaattgatttatggaagaccaattcaagaacc |
318 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
27136523 |
gaccaaattgacttatggaagaccaattcaggaacc |
27136488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 4349735 - 4349783
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
4349735 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
4349783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 27474377 - 27474425
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
27474377 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
27474425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 28 - 93
Target Start/End: Complemental strand, 27136685 - 27136620
Alignment:
| Q |
28 |
gtatgcgggagctttagtgcactagggtgcccaacaatggtgagattacatcactccaaattttcc |
93 |
Q |
| |
|
||||||||||||| ||||||| | | ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27136685 |
gtatgcgggagctccagtgcaccggacttcccaacaatggtgagattacatctctccaaattttcc |
27136620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 46248014 - 46247969
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtg |
46 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
46248014 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
46247969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 6925197 - 6925245
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
6925197 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcac |
6925245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10668324 - 10668372
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10668324 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcac |
10668372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 19414534 - 19414582
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
19414534 |
atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcac |
19414582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 19701668 - 19701716
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||| || ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
19701668 |
atggtggggccccttcccggaccctgcgtatgcgggagctttagtgcac |
19701716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 33594191 - 33594143
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcact |
50 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcact |
33594143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35005222 - 35005270
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
35005222 |
atggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcac |
35005270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42304268 - 42304220
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
42304268 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcac |
42304220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45402193 - 45402241
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
45402193 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcac |
45402241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 46991901 - 46991949
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
46991901 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcac |
46991949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 50606500 - 50606548
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
50606500 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
50606548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27201746 - 27201793
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||| |
|
|
| T |
27201746 |
atggtgggaccccttcccggaccttgcgtatgcgggagctttagtgca |
27201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 15505661 - 15505702
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagcttt |
42 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
15505661 |
atggtgggaccccttcccgaaccctgcgtatgcgggagcttt |
15505702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 18944742 - 18944783
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagcttt |
42 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
18944742 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttt |
18944783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2435847 - 2435799
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||| |||||| || || |||||||||||||||||||| |
|
|
| T |
2435847 |
atggtgggacccctttccgtaccctccgcatgcgggagctttagtgcac |
2435799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4587624 - 4587576
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| ||||||||||||| ||||||| |
|
|
| T |
4587624 |
atggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcac |
4587576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 14617135 - 14617183
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||| | ||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
14617135 |
atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcac |
14617183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 18742018 - 18741970
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| |||||||||||||| |
|
|
| T |
18742018 |
atggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcac |
18741970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30395787 - 30395739
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
30395787 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
30395739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30555212 - 30555260
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||| || || ||||||||||| |||||||||||||| |
|
|
| T |
30555212 |
atggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcac |
30555260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34725159 - 34725111
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
34725159 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
34725111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35253248 - 35253200
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
35253248 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
35253200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 34)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 20908697 - 20908639
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
20908697 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccc |
20908639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 30690236 - 30690179
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
30690236 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgccc |
30690179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20639719 - 20639671
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
20639719 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
20639671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 38755969 - 38755921
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
38755969 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
38755921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 44363191 - 44363143
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
44363191 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
44363143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33836548 - 33836501
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
33836548 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
33836501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 5648332 - 5648390
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||| |||||||| || ||||| |
|
|
| T |
5648332 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccc |
5648390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 14983908 - 14983953
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtg |
46 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
14983908 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
14983953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 21489162 - 21489211
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcact |
50 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||| ||||||| |
|
|
| T |
21489162 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcact |
21489211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 6430687 - 6430639
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
6430687 |
atggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcac |
6430639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11394926 - 11394974
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
11394926 |
atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcac |
11394974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11404653 - 11404701
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
11404653 |
atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcac |
11404701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 23501863 - 23501911
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
23501863 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
23501911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30352641 - 30352593
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||| || || |||||||||||||||||||||||||| |
|
|
| T |
30352641 |
atggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcac |
30352593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32484307 - 32484355
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
32484355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35567244 - 35567292
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
35567244 |
atggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcac |
35567292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 37038172 - 37038136
Alignment:
| Q |
13 |
cttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37038172 |
cttcccgtaccctgcgtatgcgggagctttagtgcac |
37038136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40553998 - 40553950
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||| |||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcac |
40553950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 47482911 - 47482864
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
47482911 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttggtgca |
47482864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 30639453 - 30639511
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
|||||| |||| ||||||| || |||| |||||||||||||||||||||| || ||||| |
|
|
| T |
30639453 |
atggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccc |
30639511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 487187 - 487139
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||| |||||| ||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
487187 |
atggcgggaccccttcccggattctgcgaatgcgggagctttagtgcac |
487139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 7909342 - 7909294
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgc-gggagctttagtgca |
48 |
Q |
| |
|
||||||||||| ||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
7909342 |
atggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgca |
7909294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 16911638 - 16911682
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagt |
45 |
Q |
| |
|
||||||||||| ||||||| || ||||||| |||||||||||||| |
|
|
| T |
16911638 |
atggtgggaccccttcccggaccctgcgtacgcgggagctttagt |
16911682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 20225056 - 20225104
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
20225056 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
20225104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 20225150 - 20225198
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
20225150 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
20225198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25388250 - 25388298
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||| |||||||||||||| |
|
|
| T |
25388250 |
atggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcac |
25388298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25629123 - 25629171
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || || | ||||||||||||||||||||| |
|
|
| T |
25629123 |
atggtgggaccccttcccggaccctacatatgcgggagctttagtgcac |
25629171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29207959 - 29207911
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
29207959 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
29207911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 35532078 - 35532114
Alignment:
| Q |
13 |
cttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| |
|
|
| T |
35532078 |
cttcccggaccctgcgtatgcgggagctttagtgcac |
35532114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 38786683 - 38786731
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
38786683 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
38786731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 40915902 - 40915950
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||| | ||||||| || |||||||||||||||||| ||||||| |
|
|
| T |
40915902 |
atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcac |
40915950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 49796871 - 49796911
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctt |
41 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
49796871 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 51865099 - 51865051
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||| || ||||||| || |||||||||||||||||||| ||||| |
|
|
| T |
51865099 |
atggtggggccccttcccggaccctgcgtatgcgggagctttattgcac |
51865051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 54730338 - 54730374
Alignment:
| Q |
13 |
cttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| |
|
|
| T |
54730338 |
cttcccggaccctgcgtatgcgggagctttagtgcac |
54730374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 22)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 14444802 - 14444860
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
14444802 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccc |
14444860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 9671253 - 9671301
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
9671253 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
9671301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10543774 - 10543822
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
10543774 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10543822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10546237 - 10546285
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
10546237 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10546285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 14530394 - 14530442
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
14530394 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
14530442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 34766330 - 34766376
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
34766376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 8455377 - 8455329
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
8455377 |
atggtgggaccccttcccggaccctgcgtatgccggagctttagtgcac |
8455329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 23488557 - 23488605
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
23488557 |
atggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcac |
23488605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 50
Target Start/End: Original strand, 24890486 - 24890534
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcact |
50 |
Q |
| |
|
|||||||||| ||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
24890486 |
tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcact |
24890534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 26684681 - 26684633
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||| ||||| |
|
|
| T |
26684681 |
atggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcac |
26684633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36871566 - 36871613
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
36871566 |
atggtgggaccccttcccggac-ctgcgtatgcgggagctttagtgcac |
36871613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40579810 - 40579762
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcac |
40579762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 5841104 - 5841152
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
5841104 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
5841152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 8575975 - 8576027
Alignment:
| Q |
7 |
ggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||| ||||||| || ||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgccc |
8576027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11514510 - 11514557
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
11514510 |
atggtgggacc-cttcccagaccctgcgtatgcgggagctttagtgcac |
11514557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 14544140 - 14544188
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||| ||||| ||||| | || |||||||||||||||||||||||||| |
|
|
| T |
14544140 |
atggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcac |
14544188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21779322 - 21779274
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
21779322 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
21779274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 25079778 - 25079730
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||| |||||||||||||| |
|
|
| T |
25079778 |
atggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcac |
25079730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 25249799 - 25249751
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||| | ||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
25249799 |
atggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcac |
25249751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 31158500 - 31158456
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagt |
45 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
31158500 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagt |
31158456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 41409936 - 41409984
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| ||||||||||||| ||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcac |
41409984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 44643597 - 44643645
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||| ||||||||| |
|
|
| T |
44643597 |
atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcac |
44643645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 10884 - 10933
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcact |
50 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
10884 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcact |
10933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 46905 - 46953
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
46905 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
46953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24833 - 24786
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
24833 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
24786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 11)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29355916 - 29355868
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
29355916 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
29355868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 6808469 - 6808517
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
6808469 |
atggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcac |
6808517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 9161198 - 9161256
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| |||| || || |||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
9161198 |
atggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccc |
9161256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 12221976 - 12221935
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagcttt |
42 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
12221976 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttt |
12221935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 24097651 - 24097696
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtg |
46 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||| |||||||||| |
|
|
| T |
24097651 |
atggtgggaccccttcccggaccctgcgtatgcggaagctttagtg |
24097696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 1347036 - 1347084
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
1347036 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
1347084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 1354818 - 1354770
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
1354818 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
1354770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 12885987 - 12886035
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || ||||||||| |||||||||||||||| |
|
|
| T |
12885987 |
atggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcac |
12886035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 12892083 - 12892131
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
12892083 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
12892131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13267799 - 13267847
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||| | || |||||||||||||||||| ||||||| |
|
|
| T |
13267799 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcac |
13267847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 23930188 - 23930140
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||| || || |||| ||||||||||||||||||||| |
|
|
| T |
23930188 |
atggtgggaccccttcacggaccctgcttatgcgggagctttagtgcac |
23930140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 17)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16957388 - 16957436
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
16957388 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
16957436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 25622534 - 25622582
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
25622534 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
25622582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 38879657 - 38879705
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
38879657 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
38879705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7097821 - 7097773
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||| |||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
7097821 |
atggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
7097773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 24448964 - 24449012
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
24448964 |
atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24449012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 43574680 - 43574728
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
43574680 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagagcac |
43574728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 2 - 49
Target Start/End: Original strand, 3771414 - 3771461
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
3771414 |
tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcac |
3771461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 21542528 - 21542489
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagct |
40 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
21542528 |
atggtgggaccccttcccggactctgcgtatgcgggagct |
21542489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27328828 - 27328875
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||| |||| |
|
|
| T |
27328828 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgca |
27328875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 10306535 - 10306493
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagcttta |
43 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
10306535 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 19143004 - 19142955
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcact |
50 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
19143004 |
atggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcact |
19142955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12006389 - 12006341
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || |||| ||||||||||||||||||||| |
|
|
| T |
12006389 |
atggtgggaccccttcccagaccctgcctatgcgggagctttagtgcac |
12006341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12477181 - 12477133
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
12477181 |
atggtgggaccccttcccggattctgcgtatgcaagagctttagtgcac |
12477133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 16880708 - 16880660
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||| |||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
16880708 |
atggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcac |
16880660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21784393 - 21784345
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||| ||| || ||||||||||||||| |||||||||| |
|
|
| T |
21784393 |
atggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcac |
21784345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32703496 - 32703544
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
32703496 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
32703544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 43334279 - 43334326
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
43334279 |
atggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcac |
43334326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000008; HSPs: 25)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 13628851 - 13628803
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
13628851 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
13628803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40272873 - 40272825
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
40272873 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
40272825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 54484787 - 54484835
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
54484787 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
54484835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 29366781 - 29366723
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || ||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
29366781 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccc |
29366723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 829503 - 829455
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
829503 |
atggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcac |
829455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 45948898 - 45948851
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||||| |||| || || |||||||||||||||||||||||||| |
|
|
| T |
45948898 |
tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcac |
45948851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 10795484 - 10795426
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||| | || |||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
10795484 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgccc |
10795426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 16735536 - 16735594
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||| ||||| |||||||| || ||||| |
|
|
| T |
16735536 |
atggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccc |
16735594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 46421096 - 46421054
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagcttta |
43 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
46421096 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttta |
46421054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 14266431 - 14266375
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
|||||||||| ||||| | || ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
14266431 |
tggtgggacc-cttcctgaaccctgcgtatgcgggagctttagtgcactgggttgccc |
14266375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 26573224 - 26573281
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
|||||||||| | ||||| || ||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
26573224 |
tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccc |
26573281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 54374406 - 54374349
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgcc |
58 |
Q |
| |
|
||||||||||| ||||||| || |||| ||||||||||||||||| ||| ||| |||| |
|
|
| T |
54374406 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagttcaccaggctgcc |
54374349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 353410 - 353362
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
353410 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
353362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 516508 - 516556
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||| |||||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
516508 |
atggcgggaccccttccccgaccctgcgtatgcgggagctttagtgcac |
516556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5173780 - 5173732
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||| || ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
5173780 |
atggtggggccccttcccggaccttgcgtatgcgggagctttagtgcac |
5173732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 13730663 - 13730615
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
13730663 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
13730615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 22609861 - 22609909
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
22609861 |
atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcac |
22609909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 24851362 - 24851314
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
24851362 |
atggtgggaccccttcccggatcctgcatatgcgggagctttagtgcac |
24851314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 25517231 - 25517183
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
25517231 |
atggtgggaccccttcccggatcctgcgtatgctggagctttagtgcac |
25517183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34420704 - 34420656
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||| |||||||||||||||| |
|
|
| T |
34420704 |
atggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcac |
34420656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34771425 - 34771377
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
34771425 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
34771377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 39203610 - 39203658
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
39203610 |
atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcac |
39203658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 45786275 - 45786227
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||| |||| ||||||||||||||| |
|
|
| T |
45786275 |
atggtgggaccccttcccggaccctgcgaatgctggagctttagtgcac |
45786227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 52926280 - 52926232
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
52926280 |
atggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcac |
52926232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 53996626 - 53996578
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || ||||||||| |||||||||||||||| |
|
|
| T |
53996626 |
atggtgggaccccttccctgacactgcgtatgtgggagctttagtgcac |
53996578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 59053 - 59100
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
59053 |
atggtgggaccccttcccagactctgcgtatgcgggagctttagtgca |
59100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 20)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 49
Target Start/End: Original strand, 27507985 - 27508032
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
27508032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28817687 - 28817640
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgca |
48 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
28817687 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
28817640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 29877168 - 29877226
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
29877168 |
atggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccc |
29877226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 12625964 - 12626012
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| | ||||| || |||||||||||||||||||||||||| |
|
|
| T |
12625964 |
atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcac |
12626012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 20284130 - 20284082
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
20284130 |
atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcac |
20284082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21070758 - 21070710
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
21070758 |
atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcac |
21070710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35261753 - 35261801
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||| | || |||||||||||||||||||||||||| |
|
|
| T |
35261753 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcac |
35261801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36720870 - 36720918
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
36720870 |
atggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcac |
36720918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 39461055 - 39461007
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||| |||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
39461055 |
atggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcac |
39461007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 44530223 - 44530271
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||| | || |||||||||||||||||||||||||| |
|
|
| T |
44530223 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcac |
44530271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 13160775 - 13160821
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgc |
47 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||| ||||| |
|
|
| T |
13160775 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgc |
13160821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7136588 - 7136540
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
7136588 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
7136540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 8897825 - 8897777
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| ||||||||||||||| ||||| |
|
|
| T |
8897825 |
atggtgggaccccttcccggaccctgcatatgcgggagctttactgcac |
8897777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12670311 - 12670263
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
12670311 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
12670263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 26102591 - 26102639
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
26102591 |
atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcac |
26102639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 27468141 - 27468105
Alignment:
| Q |
13 |
cttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcac |
27468105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 28407477 - 28407525
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || || ||||||||||||||||| ||||| |
|
|
| T |
28407477 |
atggtgggaccccttcccggaccctacgtatgcgggagctttactgcac |
28407525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30454158 - 30454110
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
30454158 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
30454110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35107372 - 35107324
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||| |||||||| ||||||||||||| |
|
|
| T |
35107372 |
atggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcac |
35107324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45071338 - 45071386
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
45071338 |
atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcac |
45071386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 18512514 - 18512456
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
18512514 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgccc |
18512456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 21139809 - 21139759
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcacta |
51 |
Q |
| |
|
||||||||||| ||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
21139809 |
atggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcacta |
21139759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 45018983 - 45018926
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
|||||| ||| ||||||| || |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
45018983 |
tggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccc |
45018926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2541080 - 2541032
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2541080 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcac |
2541032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7879712 - 7879760
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||| ||||||| |
|
|
| T |
7879712 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcac |
7879760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35334877 - 35334829
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
35334877 |
atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
35334829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 38262253 - 38262209
Alignment:
| Q |
5 |
tgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
38262253 |
tgggaccccttcccgaacactgcgtatgcgggagctttagtgcac |
38262209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 2 - 49
Target Start/End: Original strand, 18747562 - 18747609
Alignment:
| Q |
2 |
tggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
|||||||||| ||||| | || |||||||||||||||||||||||||| |
|
|
| T |
18747562 |
tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcac |
18747609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 10693134 - 10693076
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgccc |
59 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| ||||||||| || ||||| |
|
|
| T |
10693134 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgccc |
10693076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 27889377 - 27889336
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagcttt |
42 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
27889377 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttt |
27889336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 43557548 - 43557589
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagcttt |
42 |
Q |
| |
|
||||||||||| | ||||| |||||||||||||||||||||| |
|
|
| T |
43557548 |
atggtgggaccccctcccggactctgcgtatgcgggagcttt |
43557589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21172070 - 21172022
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
21172070 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
21172022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 21566510 - 21566558
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||| ||||| ||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
21566510 |
atggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcac |
21566558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 23231635 - 23231679
Alignment:
| Q |
5 |
tgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||| ||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
23231635 |
tgggaccccttcccgaaccctgcgtatgcggcagctttagtgcac |
23231679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32758333 - 32758381
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
32758333 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
32758381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 34626269 - 34626225
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagt |
45 |
Q |
| |
|
||||||||| | ||||||| || |||||||||||||||||||||| |
|
|
| T |
34626269 |
atggtgggatcccttcccggaccctgcgtatgcgggagctttagt |
34626225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 39123969 - 39124017
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || ||||||||| ||||||||| |||||| |
|
|
| T |
39123969 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcac |
39124017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 40463950 - 40463998
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||| || || |||||||||||||||||| ||||||| |
|
|
| T |
40463950 |
atggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcac |
40463998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42391161 - 42391113
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
42391161 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
42391113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 42495911 - 42495875
Alignment:
| Q |
13 |
cttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| |
|
|
| T |
42495911 |
cttcccggaccctgcgtatgcgggagctttagtgcac |
42495875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 42805600 - 42805648
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || | || ||||||||||||||||||||| |
|
|
| T |
42805600 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
42805648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 48735183 - 48735135
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
48735183 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
48735135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 1644 - 1591
Alignment:
| Q |
5 |
tgggaccgcttcccgtactctgcgtatgcgggagctttagtgcactagggtgcc |
58 |
Q |
| |
|
||||||| ||||||| || | |||||||||||||||||||||||| ||| |||| |
|
|
| T |
1644 |
tgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 3622 - 3666
Alignment:
| Q |
5 |
tgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||| ||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
3622 |
tgggaccccttcccgaaccctgcgtatgcggcagctttagtgcac |
3666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 13085 - 13037
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||| |||||||||||| |
|
|
| T |
13085 |
atggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcac |
13037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 24194 - 24146
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
24194 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
24146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 30651 - 30699
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
30651 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
30699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 48695 - 48647
Alignment:
| Q |
1 |
atggtgggaccgcttcccgtactctgcgtatgcgggagctttagtgcac |
49 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||||||| |||||||| |
|
|
| T |
48695 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
48647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University