View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_14 (Length: 249)
Name: NF13714_low_14
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_14 |
 | |
|
| [»] scaffold0726 (2 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 92 - 234
Target Start/End: Complemental strand, 24754213 - 24754050
Alignment:
| Q |
92 |
tcaagtatgtcggatggagatggagttgttgatatcaaggatggagttcgtgatctcgtgttagaggacgtcgag---------------------aatg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24754213 |
tcaagtatgtcggatggagatggagttgttgatatcaaggatggagttcgtgatctcgtgttagaggacgtcgagaatgtagttggggatggagtgaatg |
24754114 |
T |
|
| Q |
171 |
cagagtattttccccctgtaatcacacgagaaatgagggtgaggttaactcctccccttgtatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24754113 |
cagagtattttccccctgtaatcacacgagaaatgagggtgatgttaactcctccccttgtatt |
24754050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0726 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: scaffold0726
Description:
Target: scaffold0726; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 92 - 170
Target Start/End: Complemental strand, 6300 - 6222
Alignment:
| Q |
92 |
tcaagtatgtcggatggagatggagttgttgatatcaaggatggagttcgtgatctcgtgttagaggacgtcgagaatg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
6300 |
tcaagtatgtcggatggagatggagttggtgatatcaaggatggagttcgtgatctcttgttagatgacgtcgagaatg |
6222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0726; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 6160 - 6107
Alignment:
| Q |
181 |
tccccctgtaatcacacgagaaatgagggtgaggttaactcctccccttgtatt |
234 |
Q |
| |
|
||||| ||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6160 |
tccccttgtaatcccacgagaattgagggtgaggttaactcctccccttgtatt |
6107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University