View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_16 (Length: 244)
Name: NF13714_low_16
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 62 - 237
Target Start/End: Original strand, 38933916 - 38934088
Alignment:
| Q |
62 |
atgcttgccatgaaactatgcattgttttttaacctattgcaatgtttatgtgttggcaattgctttgacattttagcttaaacatgttccgtttaagaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
38933916 |
atgcttgccatgaaactatgcattgttt---aacctattgcaatgtttatgtgttggcaattgctttgaccttttagcttaaacatgttccatttaagaa |
38934012 |
T |
|
| Q |
162 |
ttcatggtggcttattttcctatacttgcttttagcttaagtgttgtatgcatttttgttttatgatgatgatgtc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38934013 |
ttcatggtggcttattttcctatacttgcttttagcttaagtgttatatgcatttttgttttatgatgatgatgtc |
38934088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 38933828 - 38933887
Alignment:
| Q |
1 |
tttttgaacatggcggagaaagagggactaacttgataactctcttgtcaaatatgaagt |
60 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38933828 |
tttttgaacatggtggagaaagagggactaacttgataactctcttgtcaaatatgaagt |
38933887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University