View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_18 (Length: 216)
Name: NF13714_low_18
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 24884021 - 24883811
Alignment:
| Q |
1 |
agtattaaaagcattggatattatgagagattagaggatttttagtatgtcatccttgccttgatttactgctataacttctgagtttcttagcagttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884021 |
agtattaaaagcattggatattatgagagattagaggatttttagtctgtcatccttgccttgatttactgctataacttctgagtttcttagcagttcc |
24883922 |
T |
 |
| Q |
101 |
tttgtgatgtcatccagtgctcgaatgtcacaaccgatcaataaaggggcctata--tatacaaaacaa-ttttttcttagaggatatgatattattgtg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24883921 |
tttgtgatgtcatccagtgctcgaatgtcacaaccgatcaataaaggggcctatatatatacaaaacaatttttttcttagaggatatgatattattgtg |
24883822 |
T |
 |
| Q |
198 |
aatagaataat |
208 |
Q |
| |
|
|||||| |||| |
|
|
| T |
24883821 |
aatagagtaat |
24883811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University