View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_19 (Length: 216)
Name: NF13714_low_19
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 57 - 202
Target Start/End: Complemental strand, 38933623 - 38933478
Alignment:
| Q |
57 |
tagtgattctatatgcaagaatgactttcgtaacaacccagcaacaaatttttaactaatcttgatcaaattataagaacgttgttggtttaatagcaat |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38933623 |
tagtgattctatatgcaagaatgactttcgtaacaacccagcaacaaatttttaactaatcttcatcaaattataagaacgttgttggtttaatagcaat |
38933524 |
T |
|
| Q |
157 |
attacatagatacaaaagtcacttcaaatatgaattgagaaagaaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38933523 |
attacatagatacaaaagtcacttcaaatattaattgagaaagaaa |
38933478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 38933809 - 38933765
Alignment:
| Q |
1 |
ttcggtagcatgatgaaatgcaaattttatagttattaaagcttg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38933809 |
ttcggtagcatgatgaaatgcaaattttatagttattaaagcttg |
38933765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University