View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_20 (Length: 215)
Name: NF13714_low_20
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 24884000 - 24884183
Alignment:
| Q |
16 |
aatatccaatgcttttaatactgataaccttttggttttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggtgattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884000 |
aatatccaatgcttttaatactgataaccttttggttttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggtgattt |
24884099 |
T |
|
| Q |
116 |
cctttcccctttttgttttctttggtcagtgcctctttttcaattaaaccagggatgagtctctcaggatattctcataatact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24884100 |
cctttcccctttttgttttctttggtcagtgcctctttttcaattaaaccagggatgagtctctcaggatattctgataatact |
24884183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 34593429 - 34593372
Alignment:
| Q |
53 |
ttgcagacaaattaggaattcaagggaagaaggtgaaaagtaatgatgatttggaggt |
110 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||| |||||||||| | ||||||||||||| |
|
|
| T |
34593429 |
ttgcagacaaactaggagttcaaggaaagaaagtgaaaagtactaatgatttggaggt |
34593372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University