View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_21 (Length: 211)
Name: NF13714_low_21
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 46662188 - 46661988
Alignment:
| Q |
1 |
actctcatcaaatccacagattcaattctaattctattcatttcaattctctaacgcaaccaaaacgaggggg-tgtaattagtaactattgattgttta |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46662188 |
actctcatcaaatccacagattctattctaattctattcatttcaattctctaacgcaaccaaaacgaggggggtgtaattagtaactattgattgttta |
46662089 |
T |
 |
| Q |
100 |
aactcgtcgtgaagatgcaatcaactaacggttctgattcgaaaccaacggaacagagtagtaacaacaggccgcaacagaaaactccgccgccaccttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46662088 |
aactcgtcgtgaagatgcaatcaactaacggttctgattcgaaaccaacggaacagagtagtaacaacaggccgcaacagaaaactccgccgccaccttc |
46661989 |
T |
 |
| Q |
200 |
a |
200 |
Q |
| |
|
| |
|
|
| T |
46661988 |
a |
46661988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University