View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13714_low_21 (Length: 211)

Name: NF13714_low_21
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13714_low_21
NF13714_low_21
[»] chr3 (1 HSPs)
chr3 (1-200)||(46661988-46662188)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 46662188 - 46661988
Alignment:
1 actctcatcaaatccacagattcaattctaattctattcatttcaattctctaacgcaaccaaaacgaggggg-tgtaattagtaactattgattgttta 99  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
46662188 actctcatcaaatccacagattctattctaattctattcatttcaattctctaacgcaaccaaaacgaggggggtgtaattagtaactattgattgttta 46662089  T
100 aactcgtcgtgaagatgcaatcaactaacggttctgattcgaaaccaacggaacagagtagtaacaacaggccgcaacagaaaactccgccgccaccttc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46662088 aactcgtcgtgaagatgcaatcaactaacggttctgattcgaaaccaacggaacagagtagtaacaacaggccgcaacagaaaactccgccgccaccttc 46661989  T
200 a 200  Q
    |    
46661988 a 46661988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University