View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13714_low_9 (Length: 442)
Name: NF13714_low_9
Description: NF13714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13714_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 190 - 430
Target Start/End: Original strand, 14402338 - 14402570
Alignment:
| Q |
190 |
tgtctaaaattcatgattttatgccaagagttcagaattataaaacctcacagagctcttgagtaaaaataaagaatttgttggtgtgagaagcaaatgc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14402338 |
tgtctaaaattcatgattttatgccaagagttcagaattataaaacctcacagagttcttgagtaaaaataaagaatttgttggtgttagaagcaaatgc |
14402437 |
T |
 |
| Q |
290 |
tggagcataaggtttacatggatatgcagagtatattggaggagtattttgtttggcagtgattgttcagttttggtcatgatttgatgatttgatctcg |
389 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14402438 |
tggagcatatggtttacatggatatgcagagtatattggaggagtattttctttggcagtgattgttcagttttggtc--------atgatttgatctcg |
14402529 |
T |
 |
| Q |
390 |
ctttgaagatgattatgtttaggtaaagttggggttgccta |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14402530 |
ctttgaagatgattatgtttaggtaaagttggggttgccta |
14402570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University