View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13715_high_40 (Length: 231)
Name: NF13715_high_40
Description: NF13715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13715_high_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 9229377 - 9229169
Alignment:
| Q |
18 |
gactgcttgataacttcatttggaccgttaacctaaatttcaaccaataaagacatgccacatagatgctgactaggaccaatacctttgaaaattgaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
9229377 |
gactgcttgataacttcatttggaccgttaacctaaatttcaaccaataaagacctgccacatggatgctgactaggaccaacatctttgaaaattgaat |
9229278 |
T |
 |
| Q |
118 |
aactccatgtttgggtgtctaaaaacttgaccattat-ggtgtgattcctttacgtggtagactagaacagaacatgttaaggtgagctttccaacccag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
9229277 |
aactccatgtttgggtgtctaaaaacttaaccattatgggtgtgattcctttacgtggcagact-----agaacatgttaaggtgagctttccaa-ccag |
9229184 |
T |
 |
| Q |
217 |
gtgactgaatcattc |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9229183 |
gtgactgaatcattc |
9229169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University