View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13715_high_40 (Length: 231)

Name: NF13715_high_40
Description: NF13715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13715_high_40
NF13715_high_40
[»] chr2 (1 HSPs)
chr2 (18-231)||(9229169-9229377)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 9229377 - 9229169
Alignment:
18 gactgcttgataacttcatttggaccgttaacctaaatttcaaccaataaagacatgccacatagatgctgactaggaccaatacctttgaaaattgaat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| | |||||||||||||||    
9229377 gactgcttgataacttcatttggaccgttaacctaaatttcaaccaataaagacctgccacatggatgctgactaggaccaacatctttgaaaattgaat 9229278  T
118 aactccatgtttgggtgtctaaaaacttgaccattat-ggtgtgattcctttacgtggtagactagaacagaacatgttaaggtgagctttccaacccag 216  Q
    |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||     |||||||||||||||||||||||||| ||||    
9229277 aactccatgtttgggtgtctaaaaacttaaccattatgggtgtgattcctttacgtggcagact-----agaacatgttaaggtgagctttccaa-ccag 9229184  T
217 gtgactgaatcattc 231  Q
    |||||||||||||||    
9229183 gtgactgaatcattc 9229169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University