View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13715_low_13 (Length: 433)
Name: NF13715_low_13
Description: NF13715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13715_low_13 |
 |  |
|
| [»] scaffold0365 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0365 (Bit Score: 374; Significance: 0; HSPs: 2)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 1 - 422
Target Start/End: Original strand, 2045 - 2466
Alignment:
| Q |
1 |
agttcaagtgaatacctccaaaccctcttaacctcagctaaacccttcctccgtaacgagctcaattccattgacgccaacctcccttccctaatcacaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||| || |||| ||||||||||||||||||| |
|
|
| T |
2045 |
agttcaagtgaatacctcgaaaccctcttaacctcagctaaacccttccttcgtaacgagctcatttccatcgatcccaaactcccttccctaatcacaa |
2144 |
T |
 |
| Q |
101 |
tcctccgttcggttggtgcatccgaatgttggcacaaacatggaactttccttgaacaccttattgatattttccgcattctccatctttggaaatctcc |
200 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2145 |
tcctccgttctgttggtgcatctgaatgttggcacaaacatggaactttccttgaacaccttattgatattttccgcattctccatctttggaaatctcc |
2244 |
T |
 |
| Q |
201 |
atactccgtgtctctttgtggcctattccacccagcatactccaattcctatgttaatcttgctatctttgatccttcaacctctcgcgaagttgttcgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245 |
atactccgtgtctctttgtggcctattccactcagcatactccaattcctatgttaatcttgctatctttgatccttcaacctctcgcgaagttgttcgt |
2344 |
T |
 |
| Q |
301 |
ggacatgttggcatagaagctgagcgtctgattcatttgttttgtgttgttcctagacaatctcttattcatgatgatctactttttcattactctgata |
400 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2345 |
ggacatgttggcgtagaagctgagcgtctgattcatttgttttgtgttgttcctagacaatctcttattcatgatgatctactttttcactactctgata |
2444 |
T |
 |
| Q |
401 |
aggagctttgtcatgatcttga |
422 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2445 |
aggagctttgtcatgatcttga |
2466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 77 - 127
Target Start/End: Original strand, 17291 - 17341
Alignment:
| Q |
77 |
ccaacctcccttccctaatcacaatcctccgttcggttggtgcatccgaat |
127 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| || ||||||||||||| |
|
|
| T |
17291 |
ccaacctcccttcccgaatcacagtcctccgttccgtaggtgcatccgaat |
17341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 77 - 127
Target Start/End: Complemental strand, 14492793 - 14492743
Alignment:
| Q |
77 |
ccaacctcccttccctaatcacaatcctccgttcggttggtgcatccgaat |
127 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| || ||||||||||||| |
|
|
| T |
14492793 |
ccaacctcccttcccgaatcacagtcctccgttccgtaggtgcatccgaat |
14492743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University