View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13715_low_18 (Length: 384)
Name: NF13715_low_18
Description: NF13715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13715_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 40440752 - 40441119
Alignment:
| Q |
1 |
aacttacatgtgaccacacatattccctcaaaacctttattcattatatccaatcgaacttactatgcaacagattagctgaccagaaggccaatcacct |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40440752 |
aacttacatgtgaccacacctattccctcaaaacctttattcattatatccaatcgaacttactatgcaacagattagctgaccagaaggccaatcacct |
40440851 |
T |
 |
| Q |
101 |
ttgcatgttttgtgatgaaccatttacacctagtcaccaactcaaacgcaaaaagtctcgattattagtgttggaattagataaggatgatgacggtgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40440852 |
ttgcatgttttgtgatgaaccatttacacctagtcaccaactcaaacgcaaaaagtctcgattattagtgttggaattagataaggatgatgacggtgag |
40440951 |
T |
 |
| Q |
201 |
gttaatgatgaataaattgtcgtggaacatcgagatagtgcgtctatacttaaccctcaatttcacaatccccatctctcccttcaagccataactgcat |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40440952 |
gttaatgatgaataaattgtcatggaacatcgagatagtgcgtctatacttaaccctcaatttcacaatccccatctctcccttcaagccataactgcat |
40441051 |
T |
 |
| Q |
301 |
tgcaaattactaacctgtgtgagttttgggaatgcatgacaagaaatcattacaagtcttccttgata |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40441052 |
tgcaaattactaacctgtgtgagttttgggaatgcatgacaagaaatcattacaagtcttccttgata |
40441119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University