View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13715_low_27 (Length: 332)
Name: NF13715_low_27
Description: NF13715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13715_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 142 - 313
Target Start/End: Original strand, 31801785 - 31801955
Alignment:
| Q |
142 |
tggttaacatgtttaaaacaaatatgcatgttctagtggaaccagttaagtcttattgtgtgttttgttttggaaattgaataaagggtaaggttcctca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801785 |
tggttaacatgtttaaaacaaatatgcatgttctagtggaatcaat-aagtcttattgtgtattttgttttggaaattgaataaagggtaaggttcctca |
31801883 |
T |
|
| Q |
242 |
tgggatgaaaatagnnnnnnnnccttcttttgtttgatagttatgcattttctaattctaatgggtgattct |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801884 |
tgggatgaaaatagtttttttttcttcttttgtttgatagttatgcattttctaattctaatgggtgattct |
31801955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University