View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13715_low_28 (Length: 318)
Name: NF13715_low_28
Description: NF13715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13715_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 303
Target Start/End: Complemental strand, 16525225 - 16524934
Alignment:
| Q |
11 |
atgaagcaagcctatcaaagaaatttgctcaatctatggatgaaagcatactcaaagttagtcgttttagctttttcttcatcctctctagtgtattgga |
110 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||| | || |||||||||||| |
|
|
| T |
16525225 |
atgaagcaagcctatcacagaaatttgttcaatctatggatggaaacatactcaaagttagtcgttttagctttttcttcaacgcctttagtgtattgga |
16525126 |
T |
|
| Q |
111 |
ggctaagaaaaaggtaaagtaactattcgacacatgaacttttttgtatctcatatttttatagaaggtagtcaatgtgtagatagactagcaaatttga |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
16525125 |
ggctaagaaaaaggtggagtaactattcgacacatgaacttttttgtatctcatatttttatagaaggtagtcaatgtgtagatagtctagcaaa-ttga |
16525027 |
T |
|
| Q |
211 |
gactatcccttcaaaattatactttttggaatgatgtacccttagaacttcgtgagcaatttgtcaagaacaaactagagctgcgtagttttt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||| |
|
|
| T |
16525026 |
gactatcccttcaaaattatactttttggaatgatgtacccttagaacttcgtgagcaatttgtcaagaacaaactagggttgcgtaattttt |
16524934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University