View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13715_low_5 (Length: 574)
Name: NF13715_low_5
Description: NF13715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13715_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 9e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 9e-93
Query Start/End: Original strand, 143 - 319
Target Start/End: Complemental strand, 659953 - 659777
Alignment:
| Q |
143 |
gtaaattcttccattgaaaaattcttgaatcttgaggatgcaatgaatcttgacatgttattgttgctgacctaataaggctagttttctttctttgaat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
659953 |
gtaaattcttccattgaaaaattcttgaatcttgaggatgcaatgaatcttgacatgttattgttgctgatctaataaggctagttttctttctttgaat |
659854 |
T |
 |
| Q |
243 |
tcaaaatgaattatagaatgtaatattacaagaaacccttgaatctttaacatgaaatgtgatattataaatgagat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
659853 |
tcaaaatgaattatagaatgtaatattacaagaaacccttgaatctttaacatgaaatgtgatattataaatgagat |
659777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 660093 - 660017
Alignment:
| Q |
1 |
tctactagaaacaatatttgatggatgcaagaactaaactataatgatgacattgttgttattccatggtgttaaaa |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
660093 |
tctactagaaacaatatttgatggatgcaagaactaaactataatgatgacattgttgttattccatggtgttaaaa |
660017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 315 - 389
Target Start/End: Complemental strand, 35993697 - 35993623
Alignment:
| Q |
315 |
gagatactttggtcgtcaaagtcactaacttagctcgttacaaagtaaccattcaatggtaaaatatcaagctag |
389 |
Q |
| |
|
||||||||||||| |||||||||| |||| |||||||||||| || |||||||| ||||||| ||||||||||| |
|
|
| T |
35993697 |
gagatactttggttgtcaaagtcattaacaaagctcgttacaatgtcaccattcattggtaaattatcaagctag |
35993623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 315 - 375
Target Start/End: Complemental strand, 32275136 - 32275076
Alignment:
| Q |
315 |
gagatactttggtcgtcaaagtcactaacttagctcgttacaaagtaaccattcaatggta |
375 |
Q |
| |
|
|||| |||||||| || |||||||||||| |||||||||||| || |||||||| ||||| |
|
|
| T |
32275136 |
gagacactttggttgtaaaagtcactaacaaagctcgttacaatgtcaccattcattggta |
32275076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University