View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13717_high_18 (Length: 215)
Name: NF13717_high_18
Description: NF13717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13717_high_18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 64 - 215
Target Start/End: Complemental strand, 38638857 - 38638706
Alignment:
| Q |
64 |
ggttgaacctaacacaatctcataaaactgacttgtgagaggatgactgacctcatctcacattcggtggtacaattaatcttgaaggaagttttaaaac |
163 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
38638857 |
ggttgaacctaaaacagtctcataaaaccgacttgtgagacgatgattgacctcatctcacattcggtggtacaattaatcttgaagaaagttttgaaac |
38638758 |
T |
|
| Q |
164 |
caacgtaaaaatcattgtttagccaaacccaatccacaaaaccagcatgcaa |
215 |
Q |
| |
|
|| | |||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38638757 |
catcttaaaaatcattgttgagccaaacacaatccacaaaaccagcatgcaa |
38638706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 64 - 103
Target Start/End: Complemental strand, 38733223 - 38733184
Alignment:
| Q |
64 |
ggttgaacctaacacaatctcataaaactgacttgtgaga |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
38733223 |
ggttgaacctaacacaatctcacaaaaccgacttgtgaga |
38733184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University