View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13717_high_19 (Length: 203)
Name: NF13717_high_19
Description: NF13717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13717_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 9266678 - 9266509
Alignment:
| Q |
19 |
agacccattcaaccattccaatgaatatgcattcgaagatgttcaattattgatattaatttcttcaaaccatcagtgctaatttaagatcgaatctagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9266678 |
agacccattcaaccattccaatgaatatgcattcgaagatgttcaattattgatattaatttcttcaaaccatcagtgctaatttaagatcgaatctagt |
9266579 |
T |
 |
| Q |
119 |
tacttttatgcatataacccctttgatctatactcagaagaagcacaacccccgttcgggaaaccctttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9266578 |
tacttttatgcatataacccctttgatctatactcagaagaagcacaacccccgttcgggaaaccctttt |
9266509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University