View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13717_low_25 (Length: 203)

Name: NF13717_low_25
Description: NF13717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13717_low_25
NF13717_low_25
[»] chr1 (1 HSPs)
chr1 (19-188)||(9266509-9266678)


Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 9266678 - 9266509
Alignment:
19 agacccattcaaccattccaatgaatatgcattcgaagatgttcaattattgatattaatttcttcaaaccatcagtgctaatttaagatcgaatctagt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9266678 agacccattcaaccattccaatgaatatgcattcgaagatgttcaattattgatattaatttcttcaaaccatcagtgctaatttaagatcgaatctagt 9266579  T
119 tacttttatgcatataacccctttgatctatactcagaagaagcacaacccccgttcgggaaaccctttt 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9266578 tacttttatgcatataacccctttgatctatactcagaagaagcacaacccccgttcgggaaaccctttt 9266509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University