View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13718_high_5 (Length: 286)
Name: NF13718_high_5
Description: NF13718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13718_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 265
Target Start/End: Complemental strand, 20624674 - 20624424
Alignment:
| Q |
15 |
gattatactacgatacatgatagtacttaaatnnnnnnncacctattagaaatcaactactgatccaaaattaatgcaatctttccttgctataggttat |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20624674 |
gattatactacgatacgtgatagtacttaaataaaaaaacacctattagaaatcaactactgatccaaaattaatgtaatctttccttgctataggttat |
20624575 |
T |
|
| Q |
115 |
gtttgtttaatggtttctcagtgtacctagagtcagcattaatttcttcagatttctttagaaaccattctgcttggccactggatatgacttctggata |
214 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20624574 |
gtttatttaatggtttttcagtgtacctagagtcagcattaatttcttcagatttctttagaaaccattctgcttggccactggatatgacttctggata |
20624475 |
T |
|
| Q |
215 |
agaaccaccaccagaatctaggaagtagaggaaagcaactggtgattgcgg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20624474 |
ggaaccaccaccagaatctaggaagtagaggaaagcaactggtgattgcgg |
20624424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University