View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13718_high_8 (Length: 238)
Name: NF13718_high_8
Description: NF13718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13718_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 34710681 - 34710900
Alignment:
| Q |
1 |
tggtatttttaaactatcaagaatgaattatcaaatacttgtgtaacacgtgatatgataatttattttgtaagctcttccttatctcctagtcctagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34710681 |
tggtatttttaaactatcaagaatgaattatcaaatacttgtgtaacacgtgatatgataatttattttgtaagctcttccttatctcctagtcctagtt |
34710780 |
T |
|
| Q |
101 |
atcaaatggctataatgttttgtcnnnnnnnnnnngaagctataatgtatatatgcatcattattaacataattcgattgattgggacatcgtattaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34710781 |
atcaaatggctataatgttttgtcaaaaaaaaaaa-aggttataatgtatatatgcatcgttattagcataattcgattgattgggacatcgtattaaaa |
34710879 |
T |
|
| Q |
201 |
gtgaatcatggactaacataa |
221 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
34710880 |
gtgaatcatggattaacataa |
34710900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University