View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13718_low_13 (Length: 204)
Name: NF13718_low_13
Description: NF13718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13718_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 169
Target Start/End: Original strand, 48537142 - 48537298
Alignment:
| Q |
13 |
ccttttctgagaattatatgtggtggctccaaataacgcataccaatcaaggacatagtacgatcaaaatgatacacttcaggaacatgatcaggactca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48537142 |
ccttttctgagaattatatgtggtggctccaaataacgcataccaatcaaagacatagtacgatcaaaatgatacacttcaggaacatgatcaggactca |
48537241 |
T |
|
| Q |
113 |
atttaccctcttctttcaatgccaatgactcaaaataggctctttctttcgtcattg |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48537242 |
atttaccctcttctttcaatgccaatgactcaaaataggctctttctttcgtcattg |
48537298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University