View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13718_low_5 (Length: 386)
Name: NF13718_low_5
Description: NF13718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13718_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 204 - 364
Target Start/End: Complemental strand, 24766970 - 24766812
Alignment:
| Q |
204 |
acagggcaattcccaataatgtaaccattattactccgttgtggtccttattaaaaatagcggagttcacaacatcgtcggtatatgcaagaatgtcgta |
303 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
24766970 |
acagggtaattcccaataatgtaaccattattactccattttggtcctcattaaaaatagcggagttcacaa--tcgccggtatatgcaagaatgtcgta |
24766873 |
T |
|
| Q |
304 |
atttaaacataacacaagagtgttagcttagacattatgagtttgctgtgtaaacgctgta |
364 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
24766872 |
atttaaacataacgcaagagtggtagcttagacattatgagtttgttgtgcaaacactgta |
24766812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 60 - 135
Target Start/End: Complemental strand, 24767114 - 24767039
Alignment:
| Q |
60 |
ttaaaggttgagcagaaaaactttttcaccaccgcatgggaatctgctaacatcgacatcaagtaaacagcaaaac |
135 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24767114 |
ttaaaggttgtgcagaaaaactttttcaccattgcatgagaatctgctaacatcgacatcaagtaaacagcaaaac |
24767039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 5 - 65
Target Start/End: Complemental strand, 24767202 - 24767142
Alignment:
| Q |
5 |
caacaaatcacgtcctttgcttatccaaaagtcatagaaaaaagcgcatataaacttaaag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
24767202 |
caacaaatcacgtcctttgcttatccaaaagtcatagaaaacagtgcatataaacttaaag |
24767142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University