View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13718_low_6 (Length: 340)
Name: NF13718_low_6
Description: NF13718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13718_low_6 |
 | |
|
| [»] scaffold0450 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0450 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 210 - 325
Target Start/End: Original strand, 11118 - 11233
Alignment:
| Q |
210 |
agacattccttctttacaaaatcagctagggtcacaacaagaagtcaaagtatatgggagaaatttaaacttcataaaacattgcactagatataggcat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
11118 |
agacattccttctttacaaaatcagctagggtcacaacaagaagtcaaagtatatgggagaaattaaaacttcataaaacattgcattagatataggcat |
11217 |
T |
|
| Q |
310 |
gtgtatgagatgttcc |
325 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11218 |
gtgtatgagatgttcc |
11233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 10912 - 11000
Alignment:
| Q |
3 |
ttcctttttgtcaacattctggttgtgtacctgttgtttcccctgcttttgttggttagggttttctatttgtctggtgcctatcatta |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10912 |
ttcctttttgtcaacattctggttgtgtacttgttgtttctcctgcttttgttggttagggttttctatttgtcaggtgcctatcatta |
11000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 189
Target Start/End: Original strand, 11059 - 11095
Alignment:
| Q |
153 |
aatacttcttgtactccttgcaaacttgcactcacct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11059 |
aatacttcttgtactccttgcaaacttgcagtcacct |
11095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University