View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13718_low_7 (Length: 286)

Name: NF13718_low_7
Description: NF13718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13718_low_7
NF13718_low_7
[»] chr1 (1 HSPs)
chr1 (15-265)||(20624424-20624674)


Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 15 - 265
Target Start/End: Complemental strand, 20624674 - 20624424
Alignment:
15 gattatactacgatacatgatagtacttaaatnnnnnnncacctattagaaatcaactactgatccaaaattaatgcaatctttccttgctataggttat 114  Q
    |||||||||||||||| |||||||||||||||       ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
20624674 gattatactacgatacgtgatagtacttaaataaaaaaacacctattagaaatcaactactgatccaaaattaatgtaatctttccttgctataggttat 20624575  T
115 gtttgtttaatggtttctcagtgtacctagagtcagcattaatttcttcagatttctttagaaaccattctgcttggccactggatatgacttctggata 214  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20624574 gtttatttaatggtttttcagtgtacctagagtcagcattaatttcttcagatttctttagaaaccattctgcttggccactggatatgacttctggata 20624475  T
215 agaaccaccaccagaatctaggaagtagaggaaagcaactggtgattgcgg 265  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||    
20624474 ggaaccaccaccagaatctaggaagtagaggaaagcaactggtgattgcgg 20624424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University