View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_19 (Length: 475)
Name: NF1371_high_19
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 4e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 97 - 307
Target Start/End: Original strand, 398310 - 398529
Alignment:
| Q |
97 |
ctatggttttgaaaagtaagatatgatgaatgaatactgaataaatactatagtgttggcacttggcatgcattgtttttgagtaattatt-----tatt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
398310 |
ctatggttttgaaaagtaagatatgatgaatgaatactgaataaatactatagtgtg-----ttggcatgcattgtttttgagtaattattattattatt |
398404 |
T |
 |
| Q |
192 |
attataagtttcatagaaaagaaggagggtccactctcctcttgtcac-----ataatgcatcttcatca----acatgataaatataacaatcaaaata |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
398405 |
attataagtttcatagaaaagaaggagggtccactctcctcttgtcacataatataatgcatcttcatcaacatacatgataaatataacaatcaaaaca |
398504 |
T |
 |
| Q |
283 |
ggccccagttattaatgatctgtgg |
307 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
398505 |
ggccccagttattaatgatctgtgg |
398529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 8e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 399 - 464
Target Start/End: Original strand, 2245637 - 2245702
Alignment:
| Q |
399 |
atctctactaaaccattcattatacacaccaaattcaacttcaatttcaagttcgttcacttcttt |
464 |
Q |
| |
|
||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2245637 |
atctctactaaccccttcattatacacaacaaattcaacttcaatttcaagttcgttcacttcttt |
2245702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University