View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_33 (Length: 407)
Name: NF1371_high_33
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 29 - 191
Target Start/End: Complemental strand, 42164965 - 42164803
Alignment:
| Q |
29 |
acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagccgatgctgacatgccaccattggaggaagc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42164965 |
acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagctgatgctgacatgccaccattggaggaagc |
42164866 |
T |
 |
| Q |
129 |
tgatgctgatgcagagggtagcaagatggaagaggtcgattaagtttgaagtagttgctattg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||| |
|
|
| T |
42164865 |
tgatgctgatgcagagggtagcaagatggaagaggtcgattaattttgaaatagatgctattg |
42164803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 29 - 191
Target Start/End: Complemental strand, 42175606 - 42175444
Alignment:
| Q |
29 |
acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagccgatgctgacatgccaccattggaggaagc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42175606 |
acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagctgatgctgacatgccaccattggaggaagc |
42175507 |
T |
 |
| Q |
129 |
tgatgctgatgcagagggtagcaagatggaagaggtcgattaagtttgaagtagttgctattg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||| |
|
|
| T |
42175506 |
tgatgctgatgcagagggtagcaagatggaagaggtcgattaattttgaaatagatgctattg |
42175444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 292 - 400
Target Start/End: Complemental strand, 42175357 - 42175249
Alignment:
| Q |
292 |
ctggaccagcgtagctattgtttacgtatcgcaacttttggtgtgtcaattgttgacaatccttggtgtgtccttttatattttgatacaaattcgtgct |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42175357 |
ctggaccagcgtagctattgtttacgtatcgtaacttttggtgtgtcaattgttgacaatcgttggtgtgtccttttatattttgatacaaattcgtgct |
42175258 |
T |
 |
| Q |
392 |
tctctgctc |
400 |
Q |
| |
|
||| ||||| |
|
|
| T |
42175257 |
tctgtgctc |
42175249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 118 - 162
Target Start/End: Original strand, 37820035 - 37820079
Alignment:
| Q |
118 |
ttggaggaagctgatgctgatgcagagggtagcaagatggaagag |
162 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||||||| ||||| |
|
|
| T |
37820035 |
ttggaggaagctgatgcagatgctgagggcagcaagatgaaagag |
37820079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University