View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_high_33 (Length: 407)

Name: NF1371_high_33
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_high_33
NF1371_high_33
[»] chr5 (3 HSPs)
chr5 (29-191)||(42164803-42164965)
chr5 (29-191)||(42175444-42175606)
chr5 (292-400)||(42175249-42175357)
[»] chr7 (1 HSPs)
chr7 (118-162)||(37820035-37820079)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 29 - 191
Target Start/End: Complemental strand, 42164965 - 42164803
Alignment:
29 acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagccgatgctgacatgccaccattggaggaagc 128  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
42164965 acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagctgatgctgacatgccaccattggaggaagc 42164866  T
129 tgatgctgatgcagagggtagcaagatggaagaggtcgattaagtttgaagtagttgctattg 191  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||    
42164865 tgatgctgatgcagagggtagcaagatggaagaggtcgattaattttgaaatagatgctattg 42164803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 29 - 191
Target Start/End: Complemental strand, 42175606 - 42175444
Alignment:
29 acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagccgatgctgacatgccaccattggaggaagc 128  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
42175606 acacctttggcaacaggattcacaggatgctcaagcttggacttagcattgatgaggatgcagcagaagctgatgctgacatgccaccattggaggaagc 42175507  T
129 tgatgctgatgcagagggtagcaagatggaagaggtcgattaagtttgaagtagttgctattg 191  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||    
42175506 tgatgctgatgcagagggtagcaagatggaagaggtcgattaattttgaaatagatgctattg 42175444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 292 - 400
Target Start/End: Complemental strand, 42175357 - 42175249
Alignment:
292 ctggaccagcgtagctattgtttacgtatcgcaacttttggtgtgtcaattgttgacaatccttggtgtgtccttttatattttgatacaaattcgtgct 391  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
42175357 ctggaccagcgtagctattgtttacgtatcgtaacttttggtgtgtcaattgttgacaatcgttggtgtgtccttttatattttgatacaaattcgtgct 42175258  T
392 tctctgctc 400  Q
    ||| |||||    
42175257 tctgtgctc 42175249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 118 - 162
Target Start/End: Original strand, 37820035 - 37820079
Alignment:
118 ttggaggaagctgatgctgatgcagagggtagcaagatggaagag 162  Q
    ||||||||||||||||| ||||| ||||| ||||||||| |||||    
37820035 ttggaggaagctgatgcagatgctgagggcagcaagatgaaagag 37820079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University