View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_34 (Length: 401)
Name: NF1371_high_34
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 2484304 - 2484558
Alignment:
| Q |
1 |
ttctgtttgactgcatatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttctttgtttaactagtttctc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
2484304 |
ttctgtttgactgcacatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttgtttgtttaattggtttctc |
2484403 |
T |
 |
| Q |
101 |
cttcattagtttttctgattgattgtccctctctgttggtctcttcttcatacttttgaatgattgtatctctccctcttggtttcttcttctgattgat |
200 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2484404 |
cctcattagtttttctcattgattgtccctctctgttggtctcttcttcattcttttgattgattgtatctctccctcttgatttcttcttctgattgat |
2484503 |
T |
 |
| Q |
201 |
tggattgcttctccctgttttgattcttctaattgattgcttctctcccttttta |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
2484504 |
tggattgcttctccctgttttgattcttctaattgattgtttctcccccttttta |
2484558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 253
Target Start/End: Complemental strand, 11828434 - 11828384
Alignment:
| Q |
203 |
gattgcttctccctgttttgattcttctaattgattgcttctctccctttt |
253 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11828434 |
gattgcttctcccccttttgattcttttaattgattgcttctttccctttt |
11828384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 220 - 253
Target Start/End: Original strand, 8574429 - 8574462
Alignment:
| Q |
220 |
ttgattcttctaattgattgcttctctccctttt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8574429 |
ttgattcttctaattgattgcttctctccctttt |
8574462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University