View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_35 (Length: 399)
Name: NF1371_high_35
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 4 - 333
Target Start/End: Original strand, 48694844 - 48695176
Alignment:
| Q |
4 |
ggaggagcagagacaacaattcccaatcccgaaggcgccggcgtagtggtcaagagggtggtggtcttgatccttccgtactcaactccctacccatatc |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48694844 |
ggaggagcagtgacaacaattcccaatcccgaaggcgccggcgtagtggtcaagagggtggtggtcttgatccttccgtactcaactccctacccatatc |
48694943 |
T |
 |
| Q |
104 |
aatattcaattcaaaagaagatggttttgatttggagtgttcagtttgcctgtcggaagtggttgaaggagaaaaggtgagggttttgcctaaatgcaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48694944 |
aatattcaattcaaaagaagatggttttgatttggagtgttcagtttgcctgtcggaagtggttgaaggagaaaaggtgagggttttgcctaaatgcaat |
48695043 |
T |
 |
| Q |
204 |
cacatgtttcacatagattgcattgatatgtggttccattcccactcaacctgccctctttgcaggacaacacttgctgcaactcctcctccctcctcag |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48695044 |
cacatgtttcacatagattgcattgatatgtggttccattcccactcaacctgccctctttgcaggacaacacttgctgcaactcctcctccctcctcag |
48695143 |
T |
 |
| Q |
304 |
tagtagtagtagaag---tagaatcatcaacat |
333 |
Q |
| |
|
|||||||||||| || ||||||||||||||| |
|
|
| T |
48695144 |
tagtagtagtagtagacatagaatcatcaacat |
48695176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University