View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_46 (Length: 359)
Name: NF1371_high_46
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 130 - 329
Target Start/End: Complemental strand, 40582769 - 40582570
Alignment:
| Q |
130 |
gatggaacttagcaagggacaccaacaccattgtttctggtgatagtaacccttcctattataaagttaatgttcaggtgttaggacattgagcttccac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40582769 |
gatggaacttagcaagggacaccaacaccattgtttctggtgatagtaacccttcctattataaagttcatgttcaggtgttaggacattgagcttccac |
40582670 |
T |
 |
| Q |
230 |
gccaataacaggtgtgctggtaaaattatgttgcctcgtgtcagtagttaggcttattgttagacaagtcatcgatcactaccagagttgatgtaacaag |
329 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40582669 |
gccaataacaattgtgctggtaaaattatgttgcctcgtgtcagtagttaggcttattgttagacaagtcatcgatcactacctgagttgatgtaacaag |
40582570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 7 - 67
Target Start/End: Complemental strand, 40582892 - 40582832
Alignment:
| Q |
7 |
tcgaataatataatatctatcggctaaaaatggtacttatatttagatgtttgacacacgt |
67 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40582892 |
tcgaataaaataatatctatcggctaaaaatggtacttatatttagatgtttgacacacgt |
40582832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University