View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_54 (Length: 309)
Name: NF1371_high_54
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 190 - 298
Target Start/End: Original strand, 1819574 - 1819682
Alignment:
| Q |
190 |
gcttcaagtgaatcgatattgatttaaattttgtatagaagaaggaaaaaccatctcatgtggatctatatccaccctacttagatattatcttatctta |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1819574 |
gcttcaagtgaatcgatattgatttaaattttgtatagaagaaggaaaaaccatctcatgtggatctatatccaccctacttatatattatcttatctta |
1819673 |
T |
 |
| Q |
290 |
attattcat |
298 |
Q |
| |
|
||||||||| |
|
|
| T |
1819674 |
attattcat |
1819682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 1819401 - 1819519
Alignment:
| Q |
17 |
ttgctggtatggctgcatcatatggtgatcaaccatgaaagagctatatacttgtgtgattatgaatcttggatacgaannnnnnnnggatgaatcttgg |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1819401 |
ttgccggtatggctgcatcatatggtgatcaaccatgaaaaagctatatacttgtgtgattatgaatcttggatacgaattttttttggatgaatcttgg |
1819500 |
T |
 |
| Q |
117 |
tcaaattcgaaacaacaaa |
135 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
1819501 |
tccaattcgaaacaacaaa |
1819519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University