View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_high_75 (Length: 252)

Name: NF1371_high_75
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_high_75
NF1371_high_75
[»] chr5 (1 HSPs)
chr5 (38-66)||(2245013-2245041)


Alignment Details
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 66
Target Start/End: Complemental strand, 2245041 - 2245013
Alignment:
38 gtaacttgtttaatttgttcggttaaaca 66  Q
    |||||||||||||||||||||||||||||    
2245041 gtaacttgtttaatttgttcggttaaaca 2245013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University