View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_75 (Length: 252)
Name: NF1371_high_75
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 66
Target Start/End: Complemental strand, 2245041 - 2245013
Alignment:
| Q |
38 |
gtaacttgtttaatttgttcggttaaaca |
66 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2245041 |
gtaacttgtttaatttgttcggttaaaca |
2245013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University