View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_80 (Length: 246)
Name: NF1371_high_80
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 14928522 - 14928350
Alignment:
| Q |
1 |
aatcggtccttagatataaaaattacctgggctgaaatatgcttcagtttacggataggaggctcataaccagataagggaagtctgtcttctacaagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14928522 |
aatcggtccttagatataaaaattacctgggcagaaatatgcttcagtttacggataggaggctcataaccagataagggaagtctgtcttctacaagac |
14928423 |
T |
 |
| Q |
101 |
ctacaggagtcccagtctgccaaacaaatgatacaatatatttcttcattaattcataattatatttggaagcg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
14928422 |
ctacaggagtcccagtctgccaaacaaatgatataatata-ttcttcgttaattcataattatatttggaagcg |
14928350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University