View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_high_81 (Length: 244)

Name: NF1371_high_81
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_high_81
NF1371_high_81
[»] chr7 (2 HSPs)
chr7 (147-244)||(9939841-9939938)
chr7 (23-68)||(9939784-9939829)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 147 - 244
Target Start/End: Original strand, 9939841 - 9939938
Alignment:
147 ggtataatcgatggtgttggtgattgctaccnnnnnnntgtcgataccatacccaacataatagacgagtataatacctctatacttcaacaacaaaa 244  Q
    ||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9939841 ggtataatcgatggtgttggtgattgctacgaaaaaaatgtcgataccatacccaacataatagacgagtataatacctctatacttcaacaacaaaa 9939938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 23 - 68
Target Start/End: Original strand, 9939784 - 9939829
Alignment:
23 cacataattgttaaaaatagttaaagcatcaagatgtacatctatt 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
9939784 cacataattgttaaaaatagttaaagcatcaagatgtacatctatt 9939829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University