View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_85 (Length: 227)
Name: NF1371_high_85
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1371_high_85 |
| |
|
[»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 227
Target Start/End: Complemental strand, 10332685 - 10332479
Alignment:
Q |
21 |
attagttcatctatcatatcttatttccatgctttatcacacattgcaactttctaatctacttgctcaaaatctgctaacattgcaaagtgtaccagct |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10332685 |
attagttcatctatcatatcttatttccatgctttatcacacattgcaactttctaatctacttgctcaaaatctgctaacattgcaaagtgtaccagct |
10332586 |
T |
|
Q |
121 |
caccatcacttcctacttcatcatcaggagttagctgatagtcttcaagtcttcttggaatcagtatgtttctctatggcctcgtgatgacatgtcatct |
220 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10332585 |
caccatcacttcctacttcatcatcaggagttagctgatagtcttcaagtcttcttggtatcagtatgtttctctatggcctcgtgatgacatgtcatct |
10332486 |
T |
|
Q |
221 |
tacgtta |
227 |
Q |
|
|
||||||| |
|
|
T |
10332485 |
tacgtta |
10332479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 146
Target Start/End: Original strand, 6372691 - 6372815
Alignment:
Q |
22 |
ttagttcatctatcatatcttatttccatgctttatcacacattgcaactttctaatctacttgctcaaaatctgctaacattgcaaagtgtaccagctc |
121 |
Q |
|
|
||||||||||||| ||| ||| |||||| |||||||| | |||| |||| ||||||| | ||||| ||||||| |||||| || || |||| || |
|
|
T |
6372691 |
ttagttcatctattatagcttccttccatttcttatcacatagtgcagctttataatctaatggctcagtgtctgctagcattgcgaaatgcaccaattc |
6372790 |
T |
|
Q |
122 |
accatcacttcctacttcatcatca |
146 |
Q |
|
|
||||||||| ||||||||||||||| |
|
|
T |
6372791 |
accatcactgcctacttcatcatca |
6372815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 38018 times since January 2019
Visitors: 1232