View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_high_86 (Length: 217)

Name: NF1371_high_86
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_high_86
NF1371_high_86
[»] chr2 (1 HSPs)
chr2 (1-135)||(2484304-2484438)


Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 2484304 - 2484438
Alignment:
1 ttctgtttgactgcatatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttctttgtttaactagtttctc 100  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||    
2484304 ttctgtttgactgcacatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttgtttgtttaattggtttctc 2484403  T
101 cttcattagtttttctgattgattgtccctctctg 135  Q
    | |||||||||||||| ||||||||||||||||||    
2484404 cctcattagtttttctcattgattgtccctctctg 2484438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University