View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_89 (Length: 204)
Name: NF1371_high_89
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_89 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 18046918 - 18046801
Alignment:
| Q |
1 |
gtgatgctcagtttcatattttaatgttttctatttctctctaaaaggagtttttggaacttcacaaggaaagagaactagtcaatgatgttgataggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
18046918 |
gtgatgctcagtttcatattttaatgttttctatttctctctaaaaggagtttttggaacttcacaagcaaagagaactagtcaatgatgttggtaggtg |
18046819 |
T |
 |
| Q |
101 |
tgtttcttatatatagtg |
118 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
18046818 |
tatttcttatatatagtg |
18046801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University