View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_high_90 (Length: 202)
Name: NF1371_high_90
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_high_90 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 7 - 185
Target Start/End: Complemental strand, 11269247 - 11269069
Alignment:
| Q |
7 |
agcaccacagaaggagcaagattctcatcaataagaatattgtaatttacaaggggaatgtcaggtctactactttccttgattctctctcatctatcat |
106 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269247 |
agcaacacaaaaggagcaagattctcatcaataagaatattgtaatttacaaggggaatgttaggtctactactttccttgattctctctcatctatcat |
11269148 |
T |
 |
| Q |
107 |
tttttatatttatttactcagatatcagctccccaatccgatcatagacctgccttcattcacaaatgtgtgtcggttg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269147 |
tttttatatttatttactcagatatcagctccccaatccgatcatagacctgccttcattcacaaatgtgtgtcggttg |
11269069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University