View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_100 (Length: 251)
Name: NF1371_low_100
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_100 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 115 - 251
Target Start/End: Original strand, 52566139 - 52566276
Alignment:
| Q |
115 |
taattaggagttagattagtttgaatttgattaatggtttatggcgtacgagaataaggg-caataaagttaattatgaaatgatgattggaaattaagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52566139 |
taattaggagttagattagtttgaatttgattaatggtttatggcgtacgagaataaggtacaataaagttaattatgaaatgatgattggaaattaagg |
52566238 |
T |
 |
| Q |
214 |
tgaaggacaaaaaaggacaaataagttgcatcgttgta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52566239 |
tgaaggacaaaaaaggacaaataagttgcatcgttgta |
52566276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 29 - 87
Target Start/End: Original strand, 52566053 - 52566111
Alignment:
| Q |
29 |
aattagttcattggttcaatttaagaatattgttcactaggtttttgatactactattt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52566053 |
aattagttcattggttcaatttaagaatattgttcactaggtttttgatactactattt |
52566111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University