View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_109 (Length: 221)
Name: NF1371_low_109
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_109 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 11269101 - 11269247
Alignment:
| Q |
1 |
ctatgatcggattggggagctgatatctgagtaaataaatataaaaaatgatagatgagagagaatcaaggaaagtagtagacctgacattccccttgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11269101 |
ctatgatcggattggggagctgatatctgagtaaataaatataaaaaatgatagatgagagagaatcaaggaaagtagtagacctaacattccccttgta |
11269200 |
T |
|
| Q |
101 |
aattacaatattcttattgatgagaatcttgctccttctgtggtgct |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
11269201 |
aattacaatattcttattgatgagaatcttgctccttttgtgttgct |
11269247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5575 times since January 2019
Visitors: 8769