View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_111 (Length: 217)
Name: NF1371_low_111
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_111 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 2484304 - 2484438
Alignment:
| Q |
1 |
ttctgtttgactgcatatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttctttgtttaactagtttctc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
2484304 |
ttctgtttgactgcacatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttgtttgtttaattggtttctc |
2484403 |
T |
|
| Q |
101 |
cttcattagtttttctgattgattgtccctctctg |
135 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||| |
|
|
| T |
2484404 |
cctcattagtttttctcattgattgtccctctctg |
2484438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University