View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_113 (Length: 209)
Name: NF1371_low_113
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1371_low_113 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 11176579 - 11176706
Alignment:
Q |
1 |
aaaaaacttcaagacagtagtataaaaccaatttttaattcaagaaaatcataatatcattctttcatagattctttgatatgaggattcgtaaaaatgg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11176579 |
aaaaaacttcaagacagtagtataaaaccaatttttaattcaagaaaatcataatatcattctttcatagattctttgatatgaggattcgtaaaaatgg |
11176678 |
T |
|
Q |
101 |
ttcatttccaattgaaacttttcaagcg |
128 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
11176679 |
ttcatttccaattgaaacttttcaagcg |
11176706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 91
Target Start/End: Complemental strand, 4704061 - 4704021
Alignment:
Q |
51 |
ataatatcattctttcatagattctttgatatgaggattcg |
91 |
Q |
|
|
||||||| |||| |||||||||||||||||||||||||||| |
|
|
T |
4704061 |
ataatattattcattcatagattctttgatatgaggattcg |
4704021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5247 times since January 2019
Visitors: 5926