View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_low_115 (Length: 204)

Name: NF1371_low_115
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_low_115
NF1371_low_115
[»] chr5 (1 HSPs)
chr5 (1-118)||(18046801-18046918)


Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 18046918 - 18046801
Alignment:
1 gtgatgctcagtttcatattttaatgttttctatttctctctaaaaggagtttttggaacttcacaaggaaagagaactagtcaatgatgttgataggtg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||    
18046918 gtgatgctcagtttcatattttaatgttttctatttctctctaaaaggagtttttggaacttcacaagcaaagagaactagtcaatgatgttggtaggtg 18046819  T
101 tgtttcttatatatagtg 118  Q
    | ||||||||||||||||    
18046818 tatttcttatatatagtg 18046801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University