View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_28 (Length: 443)
Name: NF1371_low_28
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 35178798 - 35178570
Alignment:
| Q |
1 |
cattgacgagtttgtcgtagcttttgaagtttccggtgccggaagatgaaccggaaccgtagtttgtgaagtttgtgttagctacattgccgttttctgc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178798 |
cattgacgagtttatcgtagcttttgaagtttccggtgccggaagatgaaccggaaccgtagtttgtgaagtttgtgttagctacattgccgttttctgc |
35178699 |
T |
 |
| Q |
101 |
gtagctgttgaattctccgccgcgacgagttgagcctgagctgtattttttgaacgagtcgctgtttgtgtttaaaccgttggagtagtttttgaatgag |
200 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35178698 |
gtagctgttgaattcaccaccgcgacgagttgagcctgagctgtattttttgaacgagtcgctgtttgtgtttaaaccgttggagtagtttttaaatgag |
35178599 |
T |
 |
| Q |
201 |
tcgactccgccgagtcgagcggagccgta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35178598 |
tcgactccgccgagtcgagcggagccgta |
35178570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 290 - 414
Target Start/End: Complemental strand, 35178509 - 35178385
Alignment:
| Q |
290 |
ggattggtatagtgtgtttgggtggtcgaaggagcagaataagtatggtgtggagcagagggtattatggagatttgatgaggatggtttttgtttgaag |
389 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178509 |
ggattggtaaagtgtgtttgggtggtcgaaggagcagaataagtatggtgtggagcagagggtattatggagatttgatgaggatggtttttgtttgaag |
35178410 |
T |
 |
| Q |
390 |
aggtttatgaggtttgcgtagtgtt |
414 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35178409 |
aggtttatgaggtttgcgtagtgtt |
35178385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University