View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_35 (Length: 425)
Name: NF1371_low_35
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 3658807 - 3658562
Alignment:
| Q |
7 |
tccaacaatatgcaaagaagactctaaatcttgcatacaagcagacagcaagcaactattggtgatgtatttagcactttatgtcacagccctcggcact |
106 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3658807 |
tccaccaaaatgcaaagaagactctaaatcttgcatacaagcagacagcaagcaactattggtgatgtatttagcactttatatcacagccctcggcact |
3658708 |
T |
 |
| Q |
107 |
ggcggtctaaaatctagtgtctctggctttggttccgatcaatttgatgattcagatgaccaagaaaagaagggtatgattaaatttttcagctggttct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3658707 |
ggcggtctaaaatctagtgtctctggctttggttccgatcaatttgatgattcagatgaccaagaaaagaagggtatgattaaatttttcagctggttct |
3658608 |
T |
 |
| Q |
207 |
attttttcgtaagcatagggtctttggcagcagtgactgttcttgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3658607 |
attttttcgtaagcatagggtctttggcagcagtgactgttcttgt |
3658562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 76 - 155
Target Start/End: Complemental strand, 3646305 - 3646226
Alignment:
| Q |
76 |
tttagcactttatgtcacagccctcggcactggcggtctaaaatctagtgtctctggctttggttccgatcaatttgatg |
155 |
Q |
| |
|
|||||| ||||||||||| || || ||||| || ||| ||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
3646305 |
tttagcgctttatgtcactgcacttggcacagggggtttaaaatccagtgtccctggctttggttcagatcaatttgatg |
3646226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University