View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1371_low_43 (Length: 401)

Name: NF1371_low_43
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1371_low_43
NF1371_low_43
[»] chr2 (1 HSPs)
chr2 (1-255)||(2484304-2484558)
[»] chr7 (2 HSPs)
chr7 (203-253)||(11828384-11828434)
chr7 (220-253)||(8574429-8574462)


Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 2484304 - 2484558
Alignment:
1 ttctgtttgactgcatatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttctttgtttaactagtttctc 100  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||    
2484304 ttctgtttgactgcacatctcccctttatgattgcacttcacttccctctatttgattcgttctctcttttgatttgtttgtttgtttaattggtttctc 2484403  T
101 cttcattagtttttctgattgattgtccctctctgttggtctcttcttcatacttttgaatgattgtatctctccctcttggtttcttcttctgattgat 200  Q
    | |||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||    
2484404 cctcattagtttttctcattgattgtccctctctgttggtctcttcttcattcttttgattgattgtatctctccctcttgatttcttcttctgattgat 2484503  T
201 tggattgcttctccctgttttgattcttctaattgattgcttctctcccttttta 255  Q
    ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||    
2484504 tggattgcttctccctgttttgattcttctaattgattgtttctcccccttttta 2484558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 253
Target Start/End: Complemental strand, 11828434 - 11828384
Alignment:
203 gattgcttctccctgttttgattcttctaattgattgcttctctccctttt 253  Q
    |||||||||||||  ||||||||||| ||||||||||||||| ||||||||    
11828434 gattgcttctcccccttttgattcttttaattgattgcttctttccctttt 11828384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 220 - 253
Target Start/End: Original strand, 8574429 - 8574462
Alignment:
220 ttgattcttctaattgattgcttctctccctttt 253  Q
    ||||||||||||||||||||||||||||||||||    
8574429 ttgattcttctaattgattgcttctctccctttt 8574462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University