View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371_low_58 (Length: 346)
Name: NF1371_low_58
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 52 - 251
Target Start/End: Complemental strand, 44542148 - 44541949
Alignment:
| Q |
52 |
cagcaccacagacttattgtttttcaagcacttcaatcaaatagacgaatgggaaacaccgacttcaagatacccggtgcatcctacactgtcttcttaa |
151 |
Q |
| |
|
||||| |||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542148 |
cagcaacacacacttcttgtttttcaagcactgcaatcaaatagacgaatgggaaacaccgacttcaagatacccggtgcatcctacactgtcttcttaa |
44542049 |
T |
 |
| Q |
152 |
tgttaagcatgacattatggttaccaatctatgatagaatagttgttccttgtctccgaagattcaccgaaaaagaagctggcatcacagtccttcaaag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542048 |
tgttaagcatgacattatggttaccaatctatgatagaatagttgttccttgtctccgaagattcaccgaaaaagaagctggcatcacagtccttcaaag |
44541949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University